Orthologous regulated operons containing subI gene

Properties
Regulog:	CymR - Bacillales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Phylum:	Firmicutes

Built upon 65 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacillus cereus ATCC 14579
Position: -158 Score: 5.41883 Sequence: AAATTCCAAGTTGACACATATGAATTA Locus tag: BC1090 Name: subI Funciton: Sulfate ABC transporter (sulfate-binding protein) Locus tag: BC1091 Name: subI Funciton: Sulfate ABC transporter (sulfate-binding protein) Locus tag: BC1092 Name: cysT Funciton: Sulfate ABC transporter (permease) Locus tag: BC1093 Name: cysW Funciton: Sulfate ABC transporter (permease) Locus tag: BC1094 Name: cysA Funciton: Sulfate ABC transporter (ATP-binding protein)
subI-subI-cysT-cysW-cysA	-158	5.4	AAATTCCAAGTTGACACATATGAATTA	BC1090
Bacillus halodurans C-125
Position: -142 Score: 4.82737 Sequence: TAAAACCCACTTGACAGATGGGGATTA Position: -50 Score: 4.61818 Sequence: TAAAACAGACTTTTCCGATCTGTTTTA Locus tag: BH3125 Name: BH3125 Funciton: Hypothetical protein Locus tag: BH3126 Name: BH3126 Funciton: Hypothetical protein Locus tag: BH3127 Name: subI Funciton: Sulfate ABC transporter (sulfate-binding protein) Locus tag: BH3128 Name: cysT Funciton: Sulfate ABC transporter (permease) Locus tag: BH3129 Name: cysW Funciton: Sulfate ABC transporter (permease) Locus tag: BH3130 Name: cysA Funciton: Sulfate ABC transporter (ATP-binding protein)
BH3125-BH3126-subI-cysT-cysW-cysA	-142	4.8	TAAAACCCACTTGACAGATGGGGATTA	BH3125
	-50	4.6	TAAAACAGACTTTTCCGATCTGTTTTA
Paenibacillus sp. JDR-2
Position: -96 Score: 4.68336 Sequence: CATAACCAACTAAACAGGTAGGAATAA Locus tag: Pjdr2_4823 Name: subI Funciton: Sulfate ABC transporter (sulfate-binding protein) Locus tag: Pjdr2_4822 Name: cysT Funciton: Sulfate ABC transporter (permease) Locus tag: Pjdr2_4821 Name: cysW Funciton: Sulfate ABC transporter (permease) Locus tag: Pjdr2_4820 Name: null Funciton: Hypothetical protein
subI-cysT-cysW-Pjdr2_4820	-96	4.7	CATAACCAACTAAACAGGTAGGAATAA	Pjdr2_4823