Orthologous regulated operons containing BC2910 gene
| Regulog: | CymR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Cysteine metabolism |
| Effector: | O-acetyl-L-serine; CysK, cysteine synthetase |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus cereus ATCC 14579 | ||||
|
Position: -174
Score: 5.71562 Sequence: TAAAACCTAGTTGACTTATCGGAAATA
Locus tag: BC2912
Name: ssuB Funciton: Aliphatic sulfonate ABC transporter (ATP-binding protein)
Locus tag: BC2911
Name: ssuA Funciton: Aliphatic sulfonate ABC transporter (binding lipoprotein)
Locus tag: BC2910
Name: null Funciton: Alkanesulfonates transport system permease protein
Locus tag: BC2909
Name: null Funciton: Alkanesulfonate monooxygenase |
||||
| ssuB-ssuA-BC2910-BC2909 | -174 | 5.7 | TAAAACCTAGTTGACTTATCGGAAATA | BC2912 |