Orthologous regulated operons containing Pjdr2_0762 gene
| Regulog: | CymR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Cysteine metabolism |
| Effector: | O-acetyl-L-serine; CysK, cysteine synthetase |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Paenibacillus sp. JDR-2 | ||||
|
Position: -50
Score: 5.2029 Sequence: TAAATCCGATTAAACAAATAAGTAAAG
Locus tag: Pjdr2_0760
Name: ssuA Funciton: Aliphatic sulfonate ABC transporter (binding lipoprotein)
Locus tag: Pjdr2_0761
Name: null Funciton: Taurine dioxygenase
Locus tag: Pjdr2_0762
Name: null Funciton: Stress responsive alpha-beta barrel domain protein |
||||
| ssuA-Pjdr2_0761-Pjdr2_0762 | -50 | 5.2 | TAAATCCGATTAAACAAATAAGTAAAG | Pjdr2_0760 |