Orthologous regulated operons containing ssuB gene

Properties
Regulog:	CymR - Bacillales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Phylum:	Firmicutes

Built upon 65 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacillus cereus ATCC 14579
Position: -174 Score: 5.71562 Sequence: TAAAACCTAGTTGACTTATCGGAAATA Locus tag: BC2912 Name: ssuB Funciton: Aliphatic sulfonate ABC transporter (ATP-binding protein) Locus tag: BC2911 Name: ssuA Funciton: Aliphatic sulfonate ABC transporter (binding lipoprotein) Locus tag: BC2910 Name: null Funciton: Alkanesulfonates transport system permease protein Locus tag: BC2909 Name: null Funciton: Alkanesulfonate monooxygenase
ssuB-ssuA-BC2910-BC2909	-174	5.7	TAAAACCTAGTTGACTTATCGGAAATA	BC2912
Bacillus subtilis subsp. subtilis str. 168
Position: -167 Score: 4.64659 Sequence: TAAAAAAGAGTTGACATATCGGAATAA Locus tag: BSU08830 Name: ssuB Funciton: Aliphatic sulfonate ABC transporter (ATP-binding protein) Locus tag: BSU08840 Name: ssuA Funciton: Aliphatic sulfonate ABC transporter (binding lipoprotein) Locus tag: BSU08850 Name: ssuC Funciton: aliphatic sulfonate ABC transporter (permease) Locus tag: BSU08860 Name: ssuD Funciton: Alkanesulfonate monooxygenase (EC 1.14.14.5)
ssuB-ssuA-ssuC-ssuD	-167	4.6	TAAAAAAGAGTTGACATATCGGAATAA	BSU08830
Paenibacillus sp. JDR-2
Position: -53 Score: 4.90494 Sequence: TAATTCCAAGTAAATCGGTGTGAAAAA Locus tag: Pjdr2_6187 Name: ssuB Funciton: Aliphatic sulfonate ABC transporter (ATP-binding protein) Locus tag: Pjdr2_6186 Name: ssuA Funciton: Aliphatic sulfonate ABC transporter (binding lipoprotein) Locus tag: Pjdr2_6185 Name: ssuC Funciton: aliphatic sulfonate ABC transporter (permease) Locus tag: Pjdr2_6184 Name: ssuC Funciton: aliphatic sulfonate ABC transporter (permease) Locus tag: Pjdr2_6183 Name: yxeK Funciton: Putative monooxygenase
ssuB-ssuA-ssuC-ssuC-yxeK	-53	4.9	TAATTCCAAGTAAATCGGTGTGAAAAA	Pjdr2_6187