Orthologous regulated operons containing Pjdr2_5228 gene
| Regulog: | CymR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Cysteine metabolism |
| Effector: | O-acetyl-L-serine; CysK, cysteine synthetase |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Paenibacillus sp. JDR-2 | ||||
|
Position: -55
Score: 6.12095 Sequence: TAATTCTTAGTAAGTTTATAGGAATTA
Locus tag: Pjdr2_5233
Name: ytmI Funciton: Putative N-acetyltransferase
Locus tag: Pjdr2_5232
Name: null Funciton: Extracellular solute-binding protein family 3
Locus tag: Pjdr2_5231
Name: ytmL Funciton: Sulfur-containing amino acid ABC transporter (permease)
Locus tag: Pjdr2_5230
Name: ytmM Funciton: Sulfur-containing amino acid ABC transporter (permease)
Locus tag: Pjdr2_5229
Name: ytmN Funciton: Sulfur-containing amino-acid ABC transporter (ATP-binding protein)
Locus tag: Pjdr2_5228
Name: null Funciton: Luciferase-like monooxygenase
Locus tag: Pjdr2_5227
Name: ytnL Funciton: Putative aminohydrolase
Locus tag: Pjdr2_5226
Name: null Funciton: Hypothetical protein
Locus tag: Pjdr2_5225
Name: null Funciton: Nitrilotriacetate monooxygenase protein component A
Locus tag: Pjdr2_5224
Name: null Funciton: N-acyl-L-amino acid amidohydrolase |
||||
| ytmI-Pjdr2_5232-ytmL-ytmM-ytmN-Pjdr2_5228-ytnL-Pjdr2_5226-Pjdr2_5225-Pjdr2_5224 | -55 | 6.1 | TAATTCTTAGTAAGTTTATAGGAATTA | Pjdr2_5233 |