Orthologous regulated operons containing yxeK gene

Properties
Regulog:	CymR - Bacillales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Phylum:	Firmicutes

Built upon 65 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacillus amyloliquefaciens FZB42
Position: -85 Score: 5.98937 Sequence: TTATTCTTATAAAATTACTAGGAAATA Locus tag: RBAM_003900 Name: yxeK Funciton: Putative monooxygenase Locus tag: RBAM_003910 Name: yxeL Funciton: Putative acetyltransferase Locus tag: RBAM_003920 Name: yxeM Funciton: Amino acid ABC superfamily ATP binding cassette transporter, binding protein Locus tag: RBAM_003930 Name: yxeN Funciton: Amino acid ABC superfamily ATP binding cassette transporter, membrane protein Locus tag: RBAM_003940 Name: yxeO Funciton: Amino acid ABC superfamily ATP binding cassette transporter, ABC protein Locus tag: RBAM_003950 Name: yxeP Funciton: Uncharacterized hydrolase Locus tag: RBAM_003960 Name: yxeQ Funciton: Hypothetical protein
yxeK-yxeL-yxeM-yxeN-yxeO-yxeP-yxeQ	-85	6	TTATTCTTATAAAATTACTAGGAAATA	RBAM_003900
Bacillus pumilus SAFR-032
Position: -84 Score: 5.46652 Sequence: TAAAACCGATTAATTCAATCAGAAAAA Locus tag: BPUM_0345 Name: yxeK Funciton: Putative monooxygenase Locus tag: BPUM_0346 Name: yxeL Funciton: Putative acetyltransferase Locus tag: BPUM_0347 Name: yxeM Funciton: Amino acid ABC superfamily ATP binding cassette transporter, binding protein Locus tag: BPUM_0348 Name: yxeN Funciton: Amino acid ABC superfamily ATP binding cassette transporter, membrane protein Locus tag: BPUM_0349 Name: yxeO Funciton: Amino acid ABC superfamily ATP binding cassette transporter, ABC protein Locus tag: BPUM_0350 Name: yxeP Funciton: Uncharacterized hydrolase Locus tag: BPUM_0351 Name: yxeQ Funciton: Hypothetical protein
yxeK-yxeL-yxeM-yxeN-yxeO-yxeP-yxeQ	-84	5.5	TAAAACCGATTAATTCAATCAGAAAAA	BPUM_0345
Bacillus subtilis subsp. subtilis str. 168
Position: -82 Score: 5.58547 Sequence: TTATTCATATTAAACGACTAGGAATAT Locus tag: BSU39520 Name: yxeK Funciton: Putative monooxygenase Locus tag: BSU39510 Name: yxeL Funciton: Putative acetyltransferase Locus tag: BSU39500 Name: yxeM Funciton: Amino acid ABC superfamily ATP binding cassette transporter, binding protein Locus tag: BSU39490 Name: yxeN Funciton: Amino acid ABC superfamily ATP binding cassette transporter, membrane protein Locus tag: BSU39480 Name: yxeO Funciton: Amino acid ABC superfamily ATP binding cassette transporter, ABC protein Locus tag: BSU39470 Name: yxeP Funciton: Uncharacterized hydrolase Locus tag: BSU39460 Name: yxeQ Funciton: Hypothetical protein
yxeK-yxeL-yxeM-yxeN-yxeO-yxeP-yxeQ	-82	5.6	TTATTCATATTAAACGACTAGGAATAT	BSU39520
Paenibacillus sp. JDR-2
Position: -53 Score: 4.90494 Sequence: TAATTCCAAGTAAATCGGTGTGAAAAA Locus tag: Pjdr2_6187 Name: ssuB Funciton: Aliphatic sulfonate ABC transporter (ATP-binding protein) Locus tag: Pjdr2_6186 Name: ssuA Funciton: Aliphatic sulfonate ABC transporter (binding lipoprotein) Locus tag: Pjdr2_6185 Name: ssuC Funciton: aliphatic sulfonate ABC transporter (permease) Locus tag: Pjdr2_6184 Name: ssuC Funciton: aliphatic sulfonate ABC transporter (permease) Locus tag: Pjdr2_6183 Name: yxeK Funciton: Putative monooxygenase
ssuB-ssuA-ssuC-ssuC-yxeK	-53	4.9	TAATTCCAAGTAAATCGGTGTGAAAAA	Pjdr2_6187