Orthologous regulated operons containing malI gene
| Regulog: | MalI - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -248
Score: 4.77546 Sequence: CAGCATAAACGTTTTACCCA
Position: -127
Score: 6.73513 Sequence: AAGATAAAACGTTTTACCTA
Position: -48
Score: 6.10865 Sequence: TTGATAAAACGTTTTATCTG
Locus tag: CKO_01626
Name: malI Funciton: Maltose regulon regulatory protein MalI |
||||
| malI | -248 | 4.8 | CAGCATAAACGTTTTACCCA | CKO_01626 |
| -127 | 6.7 | AAGATAAAACGTTTTACCTA | ||
| -48 | 6.1 | TTGATAAAACGTTTTATCTG | ||
| Enterobacter sp. 638 | ||||
|
Position: -127
Score: 6.73513 Sequence: AAGATAAAACGTTTTACCAA
Position: -48
Score: 5.85088 Sequence: TTGATAAAACGTTTTACCGT
Locus tag: Ent638_1828
Name: malI Funciton: Maltose regulon regulatory protein MalI |
||||
| malI | -127 | 6.7 | AAGATAAAACGTTTTACCAA | Ent638_1828 |
| -48 | 5.9 | TTGATAAAACGTTTTACCGT | ||
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -126
Score: 6.9929 Sequence: AAGATAAAACGTTTTATCAA
Position: -48
Score: 6.45985 Sequence: AAGGTAAAACGTTTTATCTG
Locus tag: b1620
Name: malI Funciton: Maltose regulon regulatory protein MalI |
||||
| malI | -126 | 7 | AAGATAAAACGTTTTATCAA | b1620 |
| -48 | 6.5 | AAGGTAAAACGTTTTATCTG | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -46
Score: 6.57528 Sequence: AAGATAAAACGTTTTATCGA
Locus tag: KPN_01513
Name: malI Funciton: Maltose regulon regulatory protein MalI |
||||
| malI | -46 | 6.6 | AAGATAAAACGTTTTATCGA | KPN_01513 |
| Serratia proteamaculans 568 | ||||
|
Position: -137
Score: 6.73513 Sequence: AAGATAAAACGTTTTACCTA
Position: -59
Score: 5.01122 Sequence: CCAGTAAAACGTTTTACTGA
Locus tag: Spro_2271
Name: malI Funciton: Maltose regulon regulatory protein MalI |
||||
| malI | -137 | 6.7 | AAGATAAAACGTTTTACCTA | Spro_2271 |
| -59 | 5 | CCAGTAAAACGTTTTACTGA | ||