Orthologous regulated operons containing Cyan7425_1916 gene
| Regulog: | Zur - Cyanobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Cyanobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Cyanothece sp. PCC 7425 | ||||
|
Position: -104
Score: 6.43243 Sequence: AAGGCAATGATAATCATTATCAT
Locus tag: Cyan7425_1916
Name: Cyan7425_1916 Funciton: Hypothetical protein
Locus tag: Cyan7425_1915
Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein
Locus tag: Cyan7425_1914
Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein
Locus tag: Cyan7425_1913
Name: znuC Funciton: Zinc ABC transporter, permease protein |
||||
| Cyan7425_1916-znuA-znuB-znuC | -104 | 6.4 | AAGGCAATGATAATCATTATCAT | Cyan7425_1916 |