Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Cyan7425_1916 gene

Properties
Regulog: Zur - Cyanobacteria
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Cyanobacteria
Built upon 84 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Cyanothece sp. PCC 7425
Position: -104
Score: 6.43243
Sequence: AAGGCAATGATAATCATTATCAT
Locus tag: Cyan7425_1916
Name: Cyan7425_1916
Funciton: Hypothetical protein
Locus tag: Cyan7425_1915
Name: znuA
Funciton: Zinc ABC transporter, substrate-binding protein
Locus tag: Cyan7425_1914
Name: znuB
Funciton: Zinc ABC transporter, ATP-binding protein
Locus tag: Cyan7425_1913
Name: znuC
Funciton: Zinc ABC transporter, permease protein
Cyan7425_1916-znuA-znuB-znuC -104 6.4 AAGGCAATGATAATCATTATCAT Cyan7425_1916
© 2009-2020 RegPrecise