Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing glr0533 gene

Properties
Regulog: Zur - Cyanobacteria
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Cyanobacteria
Built upon 84 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Gloeobacter violaceus PCC 7421
Position: -40
Score: 5.62945
Sequence: TTGAGAACGACTATCATTGTTAT
Locus tag: glr0533
Name: glr0533
Funciton: Predicted metal transporter
Locus tag: glr0534
Name: yciC2
Funciton: Putative zinc chaperone, COG0523 family
Locus tag: glr0535
Name: COG2319
Funciton: WD-40 repeat-containing protein, COG2319 family
glr0533-yciC2-COG2319 -40 5.6 TTGAGAACGACTATCATTGTTAT glr0533
© 2009-2020 RegPrecise