Orthologous regulated operons containing cce_1486 gene

Properties
Regulog:	Zur - Cyanobacteria
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Cyanobacteria

Built upon 84 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cyanothece sp. ATCC 51142
Position: -31 Score: 6.68012 Sequence: ATGATAATGATAATCATTCTAGT Locus tag: cce_1485 Name: cce_1485 Funciton: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein Locus tag: cce_1486 Name: cce_1486 Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
cce_1485-cce_1486	-31	6.7	ATGATAATGATAATCATTCTAGT	cce_1485
Gloeobacter violaceus PCC 7421
Position: -56 Score: 5.29863 Sequence: TCAAGAATGATTCTCATTCTAGA Locus tag: gll1693 Name: cce_1486 Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
cce_1486	-56	5.3	TCAAGAATGATTCTCATTCTAGA	gll1693
Prochlorococcus marinus str. MIT 9313
Position: -111 Score: 5.95581 Sequence: ATGAGAATGATTCCCATTTTTAT Locus tag: PMT2202 Name: cce_1485 Funciton: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein Locus tag: PMT2201 Name: cce_1486 Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
cce_1485-cce_1486	-111	6	ATGAGAATGATTCCCATTTTTAT	PMT2202
Synechococcus elongatus PCC 7942
Position: -59 Score: 4.89761 Sequence: TAGGGAATGATAACGATTCTCAA Locus tag: Synpcc7942_1316 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein Locus tag: Synpcc7942_1317 Name: cce_1485 Funciton: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein Locus tag: Synpcc7942_1318 Name: cce_1486 Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
cce_1484-cce_1485-cce_1486	-59	4.9	TAGGGAATGATAACGATTCTCAA	Synpcc7942_1316
Synechococcus sp. WH 8102
Position: -83 Score: 6.32587 Sequence: ATGAGAATGATTATCATTTTTAC Locus tag: SYNW0970 Name: cce_1485 Funciton: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein Locus tag: SYNW0969 Name: cce_1486 Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
cce_1485-cce_1486	-83	6.3	ATGAGAATGATTATCATTTTTAC	SYNW0970
Trichodesmium erythraeum IMS101
Position: -287 Score: 5.24377 Sequence: ATTATAATCATATTTATTATTAA Locus tag: Tery_3358 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
cce_1484	-287	5.2	ATTATAATCATATTTATTATTAA	Tery_3358