Orthologous regulated operons containing yjfF gene
| Regulog: | GalR/GalS - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor (activator) |
| Biological process: | Galactose utilization |
| Effector: | Galactose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -148
Score: 4.74486 Sequence: GAATGAAAGCGATTACAAAG
Position: 0
Score: 4.55632 Sequence: ATGTGGAAGCGCTTACTTTT
Locus tag: CKO_03603
Name: ytfQ Funciton: periplasmic binding protein/LacI transcriptional regulator
Locus tag: CKO_03602
Name: ytfR Funciton: putative sugar transport protein (ABC superfamily, atp_bind)
Locus tag: CKO_03601
Name: ytfT Funciton: putative sugar transport protein (ABC superfamily, membrane)
Locus tag: CKO_03600
Name: yjfF Funciton: inner membrane ABC transporter permease protein |
||||
| ytfQ-ytfR-ytfT-yjfF | -148 | 4.7 | GAATGAAAGCGATTACAAAG | CKO_03603 |
| 0 | 4.6 | ATGTGGAAGCGCTTACTTTT | ||
| Enterobacter sp. 638 | ||||
|
Position: -148
Score: 4.87165 Sequence: GAATGAAAGCGATTACAAAC
Position: -94
Score: 4.31832 Sequence: TGATGTAACGCATTCCGTTA
Position: 0
Score: 4.14191 Sequence: ATGTGGAAGCGCTTACTACT
Locus tag: Ent638_0412
Name: ytfQ Funciton: periplasmic binding protein/LacI transcriptional regulator
Locus tag: Ent638_0413
Name: ytfR Funciton: putative sugar transport protein (ABC superfamily, atp_bind)
Locus tag: Ent638_0414
Name: ytfT Funciton: putative sugar transport protein (ABC superfamily, membrane)
Locus tag: Ent638_0415
Name: yjfF Funciton: inner membrane ABC transporter permease protein |
||||
| ytfQ-ytfR-ytfT-yjfF | -148 | 4.9 | GAATGAAAGCGATTACAAAC | Ent638_0412 |
| -94 | 4.3 | TGATGTAACGCATTCCGTTA | ||
| 0 | 4.1 | ATGTGGAAGCGCTTACTACT | ||
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -147
Score: 4.63351 Sequence: AGATGAAAGCGATTACAAAC
Position: 0
Score: 4.47592 Sequence: ATGTGGAAACGCTTACTTAT
Locus tag: b4227
Name: ytfQ Funciton: periplasmic binding protein/LacI transcriptional regulator
Locus tag: b4485
Name: ytfR Funciton: putative sugar transport protein (ABC superfamily, atp_bind)
Locus tag: b4230
Name: ytfT Funciton: putative sugar transport protein (ABC superfamily, membrane)
Locus tag: b4231
Name: yjfF Funciton: inner membrane ABC transporter permease protein |
||||
| ytfQ-ytfR-ytfT-yjfF | -147 | 4.6 | AGATGAAAGCGATTACAAAC | b4227 |
| 0 | 4.5 | ATGTGGAAACGCTTACTTAT | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -283
Score: 5.84584 Sequence: TTATGTAACCGTTTTCATTG
Position: -42
Score: 4.24872 Sequence: ATGTGGAAGCGCTTACTTCT
Locus tag: KPN_04622
Name: ytfQ Funciton: periplasmic binding protein/LacI transcriptional regulator
Locus tag: KPN_04623
Name: ytfR Funciton: putative sugar transport protein (ABC superfamily, atp_bind)
Locus tag: KPN_04624
Name: ytfT Funciton: putative sugar transport protein (ABC superfamily, membrane)
Locus tag: KPN_04625
Name: yjfF Funciton: inner membrane ABC transporter permease protein |
||||
| ytfQ-ytfR-ytfT-yjfF | -283 | 5.8 | TTATGTAACCGTTTTCATTG | KPN_04622 |
| -42 | 4.2 | ATGTGGAAGCGCTTACTTCT | ||