Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mglC gene

Properties
Regulog: GalR/GalS - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor (activator)
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/gamma
Built upon 78 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -287
Score: 5.4813
Sequence: GGATGTAACCGCTTTCAATA
Locus tag: CKO_00641
Name: mglB
Funciton: beta-methylgalactoside ABC transporter, periplasmic binding protein
Locus tag: CKO_00642
Name: mglA
Funciton: beta-methylgalactoside ABC transporter, ATP-binding protein
Locus tag: CKO_00643
Name: mglC
Funciton: beta-methylgalactoside ABC transporter, inner membrane component
mglB-mglA-mglC -287 5.5 GGATGTAACCGCTTTCAATA CKO_00641
Enterobacter sp. 638
Position: -288
Score: 5.82043
Sequence: TGATGTAACCGTTTTCAATC
Locus tag: Ent638_2750
Name: mglB
Funciton: beta-methylgalactoside ABC transporter, periplasmic binding protein
Locus tag: Ent638_2749
Name: mglA
Funciton: beta-methylgalactoside ABC transporter, ATP-binding protein
Locus tag: Ent638_2748
Name: mglC
Funciton: beta-methylgalactoside ABC transporter, inner membrane component
mglB-mglA-mglC -288 5.8 TGATGTAACCGTTTTCAATC Ent638_2750
Escherichia coli str. K-12 substr. MG1655
Position: -287
Score: 5.28164
Sequence: CGATGTAACCGCTTTCAATC
Locus tag: b2150
Name: mglB
Funciton: beta-methylgalactoside ABC transporter, periplasmic binding protein
Locus tag: b2149
Name: mglA
Funciton: beta-methylgalactoside ABC transporter, ATP-binding protein
Locus tag: b2148
Name: mglC
Funciton: beta-methylgalactoside ABC transporter, inner membrane component
mglB-mglA-mglC -287 5.3 CGATGTAACCGCTTTCAATC b2150
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -256
Score: 5.38426
Sequence: GGATGTAACCGCTTTCAATT
Locus tag: KPN_02588
Name: mglB
Funciton: beta-methylgalactoside ABC transporter, periplasmic binding protein
Locus tag: KPN_02587
Name: mglA
Funciton: beta-methylgalactoside ABC transporter, ATP-binding protein
Locus tag: KPN_02586
Name: mglC
Funciton: beta-methylgalactoside ABC transporter, inner membrane component
mglB-mglA-mglC -256 5.4 GGATGTAACCGCTTTCAATT KPN_02588
Serratia proteamaculans 568
Position: -246
Score: 6.0539
Sequence: TTGTGTAACCGTTTTCAATC
Locus tag: Spro_1563
Name: mglB
Funciton: beta-methylgalactoside ABC transporter, periplasmic binding protein
Locus tag: Spro_1564
Name: mglA
Funciton: beta-methylgalactoside ABC transporter, ATP-binding protein
Locus tag: Spro_1565
Name: mglC
Funciton: beta-methylgalactoside ABC transporter, inner membrane component
mglB-mglA-mglC -246 6.1 TTGTGTAACCGTTTTCAATC Spro_1563