Orthologous regulated operons containing cueR gene
| Regulog: | CueR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Edwardsiella tarda EIB202 | ||||
|
Position: -33
Score: 5.74102 Sequence: ACCTTCCCGCAAGGTTAAGGT
Locus tag: ETAE_1040
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -33 | 5.7 | ACCTTCCCGCAAGGTTAAGGT | ETAE_1040 |
| Enterobacter sp. 638 | ||||
|
Position: -33
Score: 5.38549 Sequence: ACCTTCCAGCAAGGTTAAGGT
Locus tag: Ent638_0963
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -33 | 5.4 | ACCTTCCAGCAAGGTTAAGGT | Ent638_0963 |
| Erwinia amylovora ATCC 49946 | ||||
|
Position: -33
Score: 5.38225 Sequence: ACCTTCCATCAAGGGGAACGT
Locus tag: EAM_1045
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -33 | 5.4 | ACCTTCCATCAAGGGGAACGT | EAM_1045 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
|
Position: -33
Score: 5.59474 Sequence: ACCTTCTAGCAAGGGGAGGGT
Locus tag: ECA1194
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -33 | 5.6 | ACCTTCTAGCAAGGGGAGGGT | ECA1194 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -33
Score: 6.17009 Sequence: ACCTTCCAGCAAGGGGAAGGT
Locus tag: KPN_00465
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -33 | 6.2 | ACCTTCCAGCAAGGGGAAGGT | KPN_00465 |
| Photorhabdus luminescens subsp. laumondii TTO1 | ||||
|
Position: -33
Score: 6.03927 Sequence: ACCTTCCCTCAAGGGTAAGGT
Locus tag: plu3823
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -33 | 6 | ACCTTCCCTCAAGGGTAAGGT | plu3823 |
| Proteus mirabilis HI4320 | ||||
|
Position: -33
Score: 6.17009 Sequence: ACCTTTCCGCAAGGGGAAGGT
Locus tag: PMI2172
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -33 | 6.2 | ACCTTTCCGCAAGGGGAAGGT | PMI2172 |
| Salmonella typhimurium LT2 | ||||
|
Position: -33
Score: 5.38549 Sequence: ACCTTCCAGCAAGGTTAAGGT
Locus tag: STM0499
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -33 | 5.4 | ACCTTCCAGCAAGGTTAAGGT | STM0499 |
| Serratia proteamaculans 568 | ||||
|
Position: -33
Score: 6.17009 Sequence: ACCTTCCAGCAAGGGGAAGGT
Locus tag: Spro_1151
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -33 | 6.2 | ACCTTCCAGCAAGGGGAAGGT | Spro_1151 |
| Yersinia pestis KIM | ||||
|
Position: -33
Score: 5.62705 Sequence: ACCTTCCAGCAAGGTGAAGGT
Locus tag: y1094
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -33 | 5.6 | ACCTTCCAGCAAGGTGAAGGT | y1094 |