Orthologous regulated operons containing MS1725 gene

Properties
Regulog:	IscR - Pasteurellales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria

Built upon 22 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Mannheimia succiniciproducens MBEL55E
Position: -69 Score: 6.16141 Sequence: ATAGTTGACTAATTTACTTGGTTAT Locus tag: MS1727 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: MS1726 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: MS1725 Name: MS1725 Funciton: Hypothetical protein Locus tag: MS1724 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: MS1723 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: MS1722 Name: hscB Funciton: Chaperone protein HscB Locus tag: MS1721 Name: hscA Funciton: Chaperone protein HscA Locus tag: MS1720 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: MS1719 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
iscR-iscS-MS1725-iscU-iscA-hscB-hscA-fdx-yfhJ	-69	6.2	ATAGTTGACTAATTTACTTGGTTAT	MS1727

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --