Orthologous regulated operons containing MS1725 gene
| Regulog: | IscR - Pasteurellales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Mannheimia succiniciproducens MBEL55E | ||||
|
Position: -69
Score: 6.16141 Sequence: ATAGTTGACTAATTTACTTGGTTAT
Locus tag: MS1727
Name: iscR Funciton: Iron-sulfur cluster regulator IscR
Locus tag: MS1726
Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: MS1725
Name: MS1725 Funciton: Hypothetical protein
Locus tag: MS1724
Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: MS1723
Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: MS1722
Name: hscB Funciton: Chaperone protein HscB
Locus tag: MS1721
Name: hscA Funciton: Chaperone protein HscA
Locus tag: MS1720
Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
Locus tag: MS1719
Name: yfhJ Funciton: putative Fe-S cluster assembly protein |
||||
| iscR-iscS-MS1725-iscU-iscA-hscB-hscA-fdx-yfhJ | -69 | 6.2 | ATAGTTGACTAATTTACTTGGTTAT | MS1727 |