Orthologous regulated operons containing NT05HA_2059 gene
| Regulog: | IscR - Pasteurellales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Actinobacillus pleuropneumoniae serovar 7 str. AP76 | ||||
|
Position: -83
Score: 5.94631 Sequence: ATTCTTGACTGTAACAGTCAGGTAT
Locus tag: APP7_0990
Name: iscR Funciton: Iron-sulfur cluster regulator IscR
Locus tag: APP7_0989
Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: APP7_0988
Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: APP7_0987
Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: APP7_0986
Name: hscB Funciton: Chaperone protein HscB
Locus tag: APP7_0985
Name: NT05HA_2059 Funciton: Conserved hypothetical protein
Locus tag: APP7_0984
Name: DUF2625 Funciton: conserved hypothetical protein, DUF2625
Locus tag: APP7_0983
Name: hscA Funciton: Chaperone protein HscA
Locus tag: APP7_0982
Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
Locus tag: APP7_0981
Name: yfhJ Funciton: putative Fe-S cluster assembly protein |
||||
| iscR-iscS-iscU-iscA-hscB-NT05HA_2059-DUF2625-hscA-fdx-yfhJ | -83 | 5.9 | ATTCTTGACTGTAACAGTCAGGTAT | APP7_0990 |