Orthologous regulated operons containing phnN gene

Properties
Regulog:	PhnF - Ralstonia
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization
Effector:
Phylum:	Proteobacteria/beta

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cupriavidus taiwanensis
Position: -174 Score: 7.02863 Sequence: CCTATACGTCTATACGTTTAGA Locus tag: RALTA_B1192 Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family Locus tag: RALTA_B1193 Name: rcsF Funciton: Protein RcsF involved in phosphonates utilization Locus tag: RALTA_B1194 Name: phnN Funciton: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
phnF-rcsF-phnN	-174	7	CCTATACGTCTATACGTTTAGA	RALTA_B1192
Ralstonia eutropha H16
Position: -174 Score: 7.02863 Sequence: CCTATACGTCTATACGTTTAGA Locus tag: H16_B1289 Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family Locus tag: H16_B1290 Name: rcsF Funciton: Protein RcsF involved in phosphonates utilization Locus tag: H16_B1291 Name: phnN Funciton: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
phnF-rcsF-phnN	-174	7	CCTATACGTCTATACGTTTAGA	H16_B1289
Ralstonia eutropha JMP134
Position: -243 Score: 6.7315 Sequence: CCTATACGTCTATACGTGTAGA Locus tag: Reut_B4185 Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family Locus tag: Reut_B4184 Name: phnM Funciton: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase Locus tag: Reut_B4183 Name: rcsF Funciton: Protein RcsF involved in phosphonates utilization Locus tag: Reut_B4182 Name: phnN Funciton: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
phnF-phnM-rcsF-phnN	-243	6.7	CCTATACGTCTATACGTGTAGA	Reut_B4185
Ralstonia metallidurans CH34
Position: -155 Score: 7.02863 Sequence: CCTATACGTCTATACGTTTAGA Locus tag: Rmet_0767 Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family Locus tag: Rmet_0768 Name: phnM Funciton: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase Locus tag: Rmet_0769 Name: rcsF Funciton: Protein RcsF involved in phosphonates utilization Locus tag: Rmet_0770 Name: phnN Funciton: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
phnF-phnM-rcsF-phnN	-155	7	CCTATACGTCTATACGTTTAGA	Rmet_0767