Orthologous regulated operons containing rcsF gene

Properties
Regulog:	PhnF - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization
Effector:
Phylum:	Proteobacteria

Built upon 24 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhizobium etli CFN 42
Position: -35 Score: 6.3856 Sequence: TTGTCTATATCAATAGACAT Locus tag: RHE_CH00167 Name: phnG Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG Locus tag: RHE_CH00166 Name: phnH Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH Locus tag: RHE_CH00165 Name: phnI Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI Locus tag: RHE_CH00164 Name: phnJ Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ Locus tag: RHE_CH00163 Name: phnK Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK Locus tag: RHE_CH00162 Name: phnL Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL Locus tag: RHE_CH00161 Name: phnO Funciton: Aminoalkylphosphonic acid N-acetyltransferase Locus tag: RHE_CH00160 Name: phnC Funciton: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1) Locus tag: RHE_CH00159 Name: phnD Funciton: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1) Locus tag: RHE_CH00158 Name: phnE2 Funciton: Phosphonate ABC transporter permease protein phnE2 (TC 3.A.1.9.1) Locus tag: RHE_CH00157 Name: phnE Funciton: Phosphonate ABC transporter permease protein (TC 3.A.1.9.1) Locus tag: RHE_CH00156 Name: rcsF Funciton: Protein RcsF involved in phosphonates utilization Locus tag: RHE_CH00155 Name: phnM Funciton: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase Locus tag: RHE_CH00154 Name: phnN Funciton: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
phnG-phnH-phnI-phnJ-phnK-phnL-phnO-phnC-phnD-phnE2-phnE-rcsF-phnM-phnN	-35	6.4	TTGTCTATATCAATAGACAT	RHE_CH00167