Orthologous regulated operons containing phnR2 gene
| Regulog: | PhnR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Phosphonate utilization; 2-aminoethylphosphonate utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Hahella chejuensis KCTC 2396 | ||||
|
Position: -28
Score: 5.35496 Sequence: TTTTTGGAATAGACCAGAAG
Locus tag: HCH_03089
Name: phnR2 Funciton: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family |
||||
| phnR2 | -28 | 5.4 | TTTTTGGAATAGACCAGAAG | HCH_03089 |