Orthologous regulated operons containing phnS2 gene
| Regulog: | PhnR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Phosphonate utilization; 2-aminoethylphosphonate utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Hahella chejuensis KCTC 2396 | ||||
|
Position: -51
Score: 6.27767 Sequence: CTTCTGGTATAGACCAGAAG
Locus tag: HCH_03088
Name: phnS2 Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component |
||||
| phnS2 | -51 | 6.3 | CTTCTGGTATAGACCAGAAG | HCH_03088 |