Orthologous regulated operons containing phnV gene
| Regulog: | PhnR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Phosphonate utilization; 2-aminoethylphosphonate utilization |
| Effector: | 2-aminoethylphosphonate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -45
Score: 6.21525 Sequence: AATCTGGTCTACACCAGAAT
Locus tag: KPN_04061
Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Locus tag: KPN_04060
Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
Locus tag: KPN_04059
Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
Locus tag: KPN_04058
Name: phnV Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
||||
| phnS-phnT-phnU-phnV | -45 | 6.2 | AATCTGGTCTACACCAGAAT | KPN_04061 |
| Salmonella typhimurium LT2 | ||||
|
Position: -48
Score: 6.02449 Sequence: AACCTGGTATAGGCCAGAAA
Locus tag: STM0429
Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Locus tag: STM0428
Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
Locus tag: STM0427
Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
Locus tag: STM0426
Name: phnV Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
||||
| phnS-phnT-phnU-phnV | -48 | 6 | AACCTGGTATAGGCCAGAAA | STM0429 |