Orthologous regulated operons containing phnT gene

Properties
Regulog:	PhnR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:	2-aminoethylphosphonate
Phylum:	Proteobacteria/gamma

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -45 Score: 6.21525 Sequence: AATCTGGTCTACACCAGAAT Locus tag: KPN_04061 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) Locus tag: KPN_04060 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: KPN_04059 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) Locus tag: KPN_04058 Name: phnV Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
phnS-phnT-phnU-phnV	-45	6.2	AATCTGGTCTACACCAGAAT	KPN_04061
Salmonella typhimurium LT2
Position: -48 Score: 6.02449 Sequence: AACCTGGTATAGGCCAGAAA Locus tag: STM0429 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) Locus tag: STM0428 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: STM0427 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) Locus tag: STM0426 Name: phnV Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
phnS-phnT-phnU-phnV	-48	6	AACCTGGTATAGGCCAGAAA	STM0429

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --