Orthologous regulated operons containing phnX gene

Properties
Regulog:	PhnR - Moraxellaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Phylum:	Proteobacteria/gamma

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Acinetobacter baumannii AB0057
Position: -21 Score: 6.25144 Sequence: CATCTGGTTTAAACCAGATT Locus tag: AB57_1572 Name: phnW Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) Locus tag: AB57_1573 Name: phnX Funciton: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
phnW-phnX	-21	6.3	CATCTGGTTTAAACCAGATT	AB57_1572

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --