Orthologous regulated operons containing phnW gene
| Regulog: | PhnR - Moraxellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Phosphonate utilization; 2-aminoethylphosphonate utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acinetobacter baumannii AB0057 | ||||
|
Position: -21
Score: 6.25144 Sequence: CATCTGGTTTAAACCAGATT
Locus tag: AB57_1572
Name: phnW Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
Locus tag: AB57_1573
Name: phnX Funciton: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
||||
| phnW-phnX | -21 | 6.3 | CATCTGGTTTAAACCAGATT | AB57_1572 |