Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing paaI2 gene

Properties
Regulog: PsrA - Caulobacterales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/alpha
Built upon 70 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter sp. K31
Position: -42
Score: 5.82967
Sequence: AGTCAAACAAATGTTTGAAT
Locus tag: Caul_4897
Name: paaI2
Funciton: Phenylacetic acid degradation protein paaI
paaI2 -42 5.8 AGTCAAACAAATGTTTGAAT Caul_4897
© 2009-2020 RegPrecise