Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing bfd gene

Properties
Regulog: Irr - Rhodospirillales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhodospirillum rubrum ATCC 11170
Position: -43
Score: 4.80991
Sequence: GGTTTTGAGTGGTTTTAATCT
Locus tag: Rru_A2196
Name: bfd
Funciton: bacterioferritin-associated ferredoxin
Locus tag: Rru_A2195
Name: bfr
Funciton: Bacterioferritin (cytochrome b1)
bfd-bfr -43 4.8 GGTTTTGAGTGGTTTTAATCT Rru_A2196
© 2009-2020 RegPrecise