Orthologous regulated operons containing sufS2 gene
| Regulog: | Irr - Rhodospirillales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Magnetospirillum magnetotacticum MS-1 | ||||
|
Position: -205
Score: 5.04377 Sequence: CTCTTAGAATAATTCTAGACG
Position: -186
Score: 6.06644 Sequence: CGATTAGAACTATTCTAAACT
Locus tag: Magn03001119
Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7) |
||||
| sufS2 | -205 | 5 | CTCTTAGAATAATTCTAGACG | Magn03001119 |
| -186 | 6.1 | CGATTAGAACTATTCTAAACT | ||