Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing CC1965 gene

Properties
Regulog: PsrA - Caulobacterales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/alpha
Built upon 70 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -30
Score: 4.82557
Sequence: CGCCCAACGAACGTTTGAAT
Locus tag: CC1967
Name: null
Funciton: acetyl-CoA acetyltransferase
Locus tag: CC1966
Name: null
Funciton: phosphoglycerate mutase family protein
Locus tag: CC1965
Name: null
Funciton: YjeF protein, function unknown
CC1967-CC1966-CC1965 -30 4.8 CGCCCAACGAACGTTTGAAT CC1967
Caulobacter segnis ATCC 21756
Position: -30
Score: 4.85294
Sequence: CCCCCAACGATCGTTTGAAT
Locus tag: Cseg_2255
Name: null
Funciton: acetyl-CoA acetyltransferase
Locus tag: Cseg_2254
Name: null
Funciton: phosphoglycerate mutase family protein
Locus tag: Cseg_2253
Name: null
Funciton: YjeF protein, function unknown
Cseg_2255-Cseg_2254-Cseg_2253 -30 4.9 CCCCCAACGATCGTTTGAAT Cseg_2255
© 2009-2020 RegPrecise