Orthologous regulated operons containing fadD2 gene
| Regulog: | PsrA - Caulobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Caulobacter crescentus CB15 | ||||
|
Position: -99
Score: 4.9729 Sequence: CCTCAAACGCATGTTTGCAT
Locus tag: CC1321
Name: fadD2 Funciton: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
||||
| fadD2 | -99 | 5 | CCTCAAACGCATGTTTGCAT | CC1321 |
| Caulobacter sp. K31 | ||||
|
Position: -97
Score: 4.95619 Sequence: GTTCGAACAGACGTTTGCAT
Locus tag: Caul_2153
Name: fadD2 Funciton: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
||||
| fadD2 | -97 | 5 | GTTCGAACAGACGTTTGCAT | Caul_2153 |