Orthologous regulated operons containing CC3087 gene
| Regulog: | PsrA - Caulobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Caulobacter crescentus CB15 | ||||
|
Position: -34
Score: 4.62752 Sequence: AAGAAAACAACTGTTTGGGC
Locus tag: CC3087
Name: null Funciton: Methylsuccinyl-CoA dehydrogenase, predicted by (Erb et al, 2007) |
||||
| CC3087 | -34 | 4.6 | AAGAAAACAACTGTTTGGGC | CC3087 |
| Caulobacter segnis ATCC 21756 | ||||
|
Position: -52
Score: 4.92723 Sequence: AAGAAAACAATTGTTTGGCT
Position: -34
Score: 5.18752 Sequence: CTTAAAACACCTGTTTGGCC
Locus tag: Cseg_3655
Name: null Funciton: Methylsuccinyl-CoA dehydrogenase, predicted by (Erb et al, 2007) |
||||
| Cseg_3655 | -52 | 4.9 | AAGAAAACAATTGTTTGGCT | Cseg_3655 |
| -34 | 5.2 | CTTAAAACACCTGTTTGGCC | ||
| Caulobacter sp. K31 | ||||
|
Position: -34
Score: 4.76953 Sequence: AAGAAAACAACTGTTTGGCG
Locus tag: Caul_1059
Name: null Funciton: Methylsuccinyl-CoA dehydrogenase, predicted by (Erb et al, 2007) |
||||
| Caul_1059 | -34 | 4.8 | AAGAAAACAACTGTTTGGCG | Caul_1059 |