Orthologous regulated operons containing CC0942 gene
| Regulog: | PsrA - Caulobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Caulobacter crescentus CB15 | ||||
|
Position: -30
Score: 5.31562 Sequence: ATCCAAACAACTGTTCGAGG
Locus tag: CC0942
Name: null Funciton: aldehyde dehydrogenase |
||||
| CC0942 | -30 | 5.3 | ATCCAAACAACTGTTCGAGG | CC0942 |
| Caulobacter segnis ATCC 21756 | ||||
|
Position: -31
Score: 5.30362 Sequence: ATCCAAACAAATGTTTGGGA
Locus tag: Cseg_3353
Name: null Funciton: aldehyde dehydrogenase |
||||
| Cseg_3353 | -31 | 5.3 | ATCCAAACAAATGTTTGGGA | Cseg_3353 |
| Caulobacter sp. K31 | ||||
|
Position: -41
Score: 4.97376 Sequence: AATCAAACAACTGTTTACAA
Locus tag: Caul_1346
Name: null Funciton: aldehyde dehydrogenase |
||||
| Caul_1346 | -41 | 5 | AATCAAACAACTGTTTACAA | Caul_1346 |