Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Cseg_1383 gene

Properties
Regulog: PsrA - Caulobacterales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/alpha
Built upon 70 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter segnis ATCC 21756
Position: -113
Score: 5.03636
Sequence: CGGCGAACGAGCGTTTGAAT
Locus tag: Cseg_1384
Name: null
Funciton: Acyl-CoA dehydrogenase family protein
Locus tag: Cseg_1383
Name: null
Funciton: DSBA oxidoreductase
Locus tag: Cseg_1382
Name: null
Funciton: Acyl-CoA dehydrogenase family protein
Cseg_1384-Cseg_1383-Cseg_1382 -113 5 CGGCGAACGAGCGTTTGAAT Cseg_1384
Caulobacter sp. K31
Position: -119
Score: 4.77876
Sequence: TGACGAACGGACGTTTGAAT
Locus tag: Caul_1447
Name: null
Funciton: Acyl-CoA dehydrogenase family protein
Locus tag: Caul_1446
Name: null
Funciton: DSBA oxidoreductase
Locus tag: Caul_1445
Name: null
Funciton: Acyl-CoA dehydrogenase family protein
Caul_1447-Caul_1446-Caul_1445 -119 4.8 TGACGAACGGACGTTTGAAT Caul_1447
© 2009-2020 RegPrecise