Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing XAC0531 gene

Properties
Regulog: PsrA - Xanthomonadales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/gamma
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Xanthomonas axonopodis pv. citri str. 306
Position: -96
Score: 5.06225
Sequence: TTTAAAACAATCGTTTTAAA
Locus tag: XAC0533
Name: aroQ
Funciton: 3-dehydroquinate dehydratase II (EC 4.2.1.10)
Locus tag: XAC0532
Name: bccP
Funciton: Biotin carboxyl carrier protein of acetyl-CoA carboxylase
Locus tag: XAC0531
Name: null
Funciton: 23S RNA associated protein
Locus tag: XAC0530
Name: accC
Funciton: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14)
aroQ-bccP-XAC0531-accC -96 5.1 TTTAAAACAATCGTTTTAAA XAC0533
Xanthomonas campestris pv. campestris str. ATCC 33913
Position: -96
Score: 5.45498
Sequence: AATCAAACGATTGTTTAAAA
Locus tag: XCC0518
Name: aroQ
Funciton: 3-dehydroquinate dehydratase II (EC 4.2.1.10)
Locus tag: XCC0517
Name: bccP
Funciton: Biotin carboxyl carrier protein of acetyl-CoA carboxylase
Locus tag: XCC0516
Name: null
Funciton: 23S RNA associated protein
Locus tag: XCC0515
Name: accC
Funciton: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14)
aroQ-bccP-XCC0516-accC -96 5.5 AATCAAACGATTGTTTAAAA XCC0518
© 2009-2020 RegPrecise