Orthologous regulated operons containing accC gene

Properties
Regulog:	PsrA - Xanthomonadales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Phylum:	Proteobacteria/gamma

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Stenotrophomonas maltophilia K279a
Position: -96 Score: 5.29949 Sequence: TTTCAAACGTTCGATTGAAA Locus tag: Smlt4239 Name: aroQ Funciton: 3-dehydroquinate dehydratase II (EC 4.2.1.10) Locus tag: Smlt4240 Name: bccP Funciton: Biotin carboxyl carrier protein of acetyl-CoA carboxylase Locus tag: Smlt4241 Name: accC Funciton: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14)
aroQ-bccP-accC	-96	5.3	TTTCAAACGTTCGATTGAAA	Smlt4239
Xanthomonas axonopodis pv. citri str. 306
Position: -96 Score: 5.06225 Sequence: TTTAAAACAATCGTTTTAAA Locus tag: XAC0533 Name: aroQ Funciton: 3-dehydroquinate dehydratase II (EC 4.2.1.10) Locus tag: XAC0532 Name: bccP Funciton: Biotin carboxyl carrier protein of acetyl-CoA carboxylase Locus tag: XAC0531 Name: null Funciton: 23S RNA associated protein Locus tag: XAC0530 Name: accC Funciton: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14)
aroQ-bccP-XAC0531-accC	-96	5.1	TTTAAAACAATCGTTTTAAA	XAC0533
Xanthomonas campestris pv. campestris str. ATCC 33913
Position: -96 Score: 5.45498 Sequence: AATCAAACGATTGTTTAAAA Locus tag: XCC0518 Name: aroQ Funciton: 3-dehydroquinate dehydratase II (EC 4.2.1.10) Locus tag: XCC0517 Name: bccP Funciton: Biotin carboxyl carrier protein of acetyl-CoA carboxylase Locus tag: XCC0516 Name: null Funciton: 23S RNA associated protein Locus tag: XCC0515 Name: accC Funciton: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14)
aroQ-bccP-XCC0516-accC	-96	5.5	AATCAAACGATTGTTTAAAA	XCC0518