Orthologous regulated operons containing fadA gene
Regulog: | PsrA - Xanthomonadales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Fatty acid degradation |
Effector: | Oleate |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Stenotrophomonas maltophilia K279a | ||||
Position: -35
Score: 5.73595 Sequence: TATCAAACAATCGTTTGATT
Locus tag: Smlt2053
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: Smlt2052
Name: fadB Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: Smlt2051
Name: fadA Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
||||
psrA-fadB-fadA | -35 | 5.7 | TATCAAACAATCGTTTGATT | Smlt2053 |
Xanthomonas axonopodis pv. citri str. 306 | ||||
Position: -37
Score: 5.56467 Sequence: ACTCAAACAATCGTTTGATT
Locus tag: XAC2014
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: XAC2013
Name: fadB Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: XAC2012
Name: fadA Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
||||
psrA-fadB-fadA | -37 | 5.6 | ACTCAAACAATCGTTTGATT | XAC2014 |
Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
Position: -37
Score: 5.56467 Sequence: ACTCAAACAATCGTTTGATT
Locus tag: XCC1980
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: XCC1979
Name: fadB Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: XCC1978
Name: fadA Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) |
||||
psrA-fadB-fadA | -37 | 5.6 | ACTCAAACAATCGTTTGATT | XCC1980 |