Orthologous regulated operons containing gluE gene

Properties
Regulog:	GluR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Glucose utilization; Trehalose utilization
Effector:	Glucose
Phylum:	Thermotogae

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermotoga naphthophila RKU-10
Position: -133 Score: 6.30633 Sequence: ATTTAATTCCTTTGGAAATTAAT Locus tag: Tnap_0597 Name: gluE Funciton: Glucose ABC transporter, substrate-binding component Locus tag: Tnap_0596 Name: gluF Funciton: Glucose ABC transporter, permease component Locus tag: Tnap_0595 Name: gluK Funciton: Glucose ABC transporter, ATP-binding component Locus tag: Tnap_0594 Name: gluR Funciton: Predicted regulator of glucose and trehalose utilization, ROK family
gluE-gluF-gluK-gluR	-133	6.3	ATTTAATTCCTTTGGAAATTAAT	Tnap_0597
Thermotoga neapolitana DSM 4359
Position: -121 Score: 6.26143 Sequence: ATTTGATTCCGTTGGAAATTAAT Locus tag: CTN_0777 Name: gluE Funciton: Glucose ABC transporter, substrate-binding component Locus tag: CTN_0776 Name: gluF Funciton: Glucose ABC transporter, permease component Locus tag: CTN_0775 Name: gluK Funciton: Glucose ABC transporter, ATP-binding component Locus tag: CTN_0774 Name: gluR Funciton: Predicted regulator of glucose and trehalose utilization, ROK family
gluE-gluF-gluK-gluR	-121	6.3	ATTTGATTCCGTTGGAAATTAAT	CTN_0777
Thermotoga sp. RQ2
Position: -121 Score: 6.30633 Sequence: ATTTAATTCCTTTGGAAATTAAT Locus tag: TRQ2_0973 Name: gluE Funciton: Glucose ABC transporter, substrate-binding component Locus tag: TRQ2_0974 Name: gluF Funciton: Glucose ABC transporter, permease component Locus tag: TRQ2_0975 Name: gluK Funciton: Glucose ABC transporter, ATP-binding component Locus tag: TRQ2_0976 Name: gluR Funciton: Predicted regulator of glucose and trehalose utilization, ROK family
gluE-gluF-gluK-gluR	-121	6.3	ATTTAATTCCTTTGGAAATTAAT	TRQ2_0973