Orthologous regulated operons containing treF gene
| Regulog: | GluR - Thermotogales |
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | Glucose utilization; Trehalose utilization |
| Effector: | Glucose |
| Phylum: | Thermotogae |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Thermotoga naphthophila RKU-10 | ||||
|
Position: -52
Score: 5.99096 Sequence: ATTTGATTATAACGTCATTTAAT
Locus tag: Tnap_0601
Name: amyE Funciton: extracellular alpha-amylase precursor
Locus tag: Tnap_0600
Name: treE Funciton: Trehalose ABC transporter, substrate-binding component
Locus tag: Tnap_0599
Name: treF Funciton: Trehalose ABC transporter, permease component 1
Locus tag: Tnap_0598
Name: treG Funciton: Trehalose ABC transporter, permease component 1 |
||||
| amyE-treE-treF-treG | -52 | 6 | ATTTGATTATAACGTCATTTAAT | Tnap_0601 |
| Thermotoga neapolitana DSM 4359 | ||||
|
Position: -387
Score: 4.82591 Sequence: ATTTgATTAtAccGTcAgTTAAc
Locus tag: CTN_0781
Name: amyE Funciton: extracellular alpha-amylase precursor
Locus tag: CTN_0780
Name: treE Funciton: Trehalose ABC transporter, substrate-binding component
Locus tag: CTN_0779
Name: treF Funciton: Trehalose ABC transporter, permease component 1
Locus tag: CTN_0778
Name: treG Funciton: Trehalose ABC transporter, permease component 1 |
||||
| amyE-treE-treF-treG | -387 | 4.8 | ATTTgATTAtAccGTcAgTTAAc | CTN_0781 |
| Thermotoga petrophila RKU-1 | ||||
|
Position: -52
Score: 5.99096 Sequence: ATTTGATTATAACGTCATTTAAT
Locus tag: Tpet_0953
Name: amyE Funciton: extracellular alpha-amylase precursor
Locus tag: Tpet_0954
Name: treE Funciton: Trehalose ABC transporter, substrate-binding component
Locus tag: Tpet_0955
Name: treF Funciton: Trehalose ABC transporter, permease component 1
Locus tag: Tpet_0956
Name: treG Funciton: Trehalose ABC transporter, permease component 1
Locus tag: Tpet_0957
Name: gluR Funciton: Predicted regulator of glucose and trehalose utilization, ROK family |
||||
| amyE-treE-treF-treG-gluR | -52 | 6 | ATTTGATTATAACGTCATTTAAT | Tpet_0953 |
| Thermotoga sp. RQ2 | ||||
|
Position: -48
Score: 5.99096 Sequence: ATTTGATTACAACGTCATTTAAC
Locus tag: TRQ2_0970
Name: treE Funciton: Trehalose ABC transporter, substrate-binding component
Locus tag: TRQ2_0971
Name: treF Funciton: Trehalose ABC transporter, permease component 1
Locus tag: TRQ2_0972
Name: treG Funciton: Trehalose ABC transporter, permease component 1 |
||||
| treE-treF-treG | -48 | 6 | ATTTGATTACAACGTCATTTAAC | TRQ2_0970 |