Orthologous regulated operons containing treE gene

Properties
Regulog:	GluR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Glucose utilization; Trehalose utilization
Effector:	Glucose
Phylum:	Thermotogae

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermotoga naphthophila RKU-10
Position: -52 Score: 5.99096 Sequence: ATTTGATTATAACGTCATTTAAT Locus tag: Tnap_0601 Name: amyE Funciton: extracellular alpha-amylase precursor Locus tag: Tnap_0600 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: Tnap_0599 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: Tnap_0598 Name: treG Funciton: Trehalose ABC transporter, permease component 1
amyE-treE-treF-treG	-52	6	ATTTGATTATAACGTCATTTAAT	Tnap_0601
Thermotoga neapolitana DSM 4359
Position: -387 Score: 4.82591 Sequence: ATTTgATTAtAccGTcAgTTAAc Locus tag: CTN_0781 Name: amyE Funciton: extracellular alpha-amylase precursor Locus tag: CTN_0780 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: CTN_0779 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: CTN_0778 Name: treG Funciton: Trehalose ABC transporter, permease component 1
amyE-treE-treF-treG	-387	4.8	ATTTgATTAtAccGTcAgTTAAc	CTN_0781
Thermotoga petrophila RKU-1
Position: -52 Score: 5.99096 Sequence: ATTTGATTATAACGTCATTTAAT Locus tag: Tpet_0953 Name: amyE Funciton: extracellular alpha-amylase precursor Locus tag: Tpet_0954 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: Tpet_0955 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: Tpet_0956 Name: treG Funciton: Trehalose ABC transporter, permease component 1 Locus tag: Tpet_0957 Name: gluR Funciton: Predicted regulator of glucose and trehalose utilization, ROK family
amyE-treE-treF-treG-gluR	-52	6	ATTTGATTATAACGTCATTTAAT	Tpet_0953
Thermotoga sp. RQ2
Position: -48 Score: 5.99096 Sequence: ATTTGATTACAACGTCATTTAAC Locus tag: TRQ2_0970 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: TRQ2_0971 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: TRQ2_0972 Name: treG Funciton: Trehalose ABC transporter, permease component 1
treE-treF-treG	-48	6	ATTTGATTACAACGTCATTTAAC	TRQ2_0970