Orthologous regulated operons containing treE gene

Properties
Regulog:	TreR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Phylum:	Thermotogae

Built upon 19 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Fervidobacterium nodosum Rt17-B1
Position: -248 Score: 5.9263 Sequence: ATATATTCGAATTTCGAATATAT Locus tag: Fnod_0450 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: Fnod_0449 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: Fnod_0448 Name: treG Funciton: Trehalose ABC transporter, permease component 2
treE-treF-treG	-248	5.9	ATATATTCGAATTTCGAATATAT	Fnod_0450
Thermosipho africanus TCF52B
Position: -327 Score: 5.93507 Sequence: TTTAATTCGAATTTCGAAAAAAT Position: -56 Score: 5.89233 Sequence: ATAAATTCGAAAATCGAAAAAAT Locus tag: THA_844 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: THA_845 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: THA_846 Name: treG Funciton: Trehalose ABC transporter, permease component 2
treE-treF-treG	-327	5.9	TTTAATTCGAATTTCGAAAAAAT	THA_844
	-56	5.9	ATAAATTCGAAAATCGAAAAAAT
Thermosipho melanesiensis BI429
Position: -316 Score: 5.59713 Sequence: ATTTTTTTGAATTTCGAAATAAT Locus tag: Tmel_1820 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: Tmel_1819 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: Tmel_1818 Name: treG Funciton: Trehalose ABC transporter, permease component 2
treE-treF-treG	-316	5.6	ATTTTTTTGAATTTCGAAATAAT	Tmel_1820
Thermotoga naphthophila RKU-10
Position: -143 Score: 5.89165 Sequence: TTATTTTCATTTAACGAAAAAAA Locus tag: Tnap_0601 Name: amyE Funciton: extracellular alpha-amylase precursor Locus tag: Tnap_0600 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: Tnap_0599 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: Tnap_0598 Name: treG Funciton: Trehalose ABC transporter, permease component 2
amyE-treE-treF-treG	-143	5.9	TTATTTTCATTTAACGAAAAAAA	Tnap_0601
Thermotoga neapolitana DSM 4359
Position: -478 Score: 5.89165 Sequence: tTaTtTTCATTTAACGAAaAAAa Locus tag: CTN_0781 Name: amyE Funciton: extracellular alpha-amylase precursor Locus tag: CTN_0780 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: CTN_0779 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: CTN_0778 Name: treG Funciton: Trehalose ABC transporter, permease component 2
amyE-treE-treF-treG	-478	5.9	tTaTtTTCATTTAACGAAaAAAa	CTN_0781
Thermotoga petrophila RKU-1
Position: -143 Score: 5.89165 Sequence: TTATTTTCATTTAACGAAAAAAA Locus tag: Tpet_0953 Name: amyE Funciton: extracellular alpha-amylase precursor Locus tag: Tpet_0954 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: Tpet_0955 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: Tpet_0956 Name: treG Funciton: Trehalose ABC transporter, permease component 2
amyE-treE-treF-treG	-143	5.9	TTATTTTCATTTAACGAAAAAAA	Tpet_0953
Thermotoga sp. RQ2
Position: -139 Score: 5.89165 Sequence: TTATTTTCATTTAACGAAAAAAA Locus tag: TRQ2_0970 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: TRQ2_0971 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: TRQ2_0972 Name: treG Funciton: Trehalose ABC transporter, permease component 2
treE-treF-treG	-139	5.9	TTATTTTCATTTAACGAAAAAAA	TRQ2_0970

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing treE gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --