Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing treY gene

Properties
Regulog: TreR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose
Phylum: Thermotogae
Built upon 19 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga lettingae TMO
Position: -8
Score: 5.70249
Sequence: ATTAATTCATGTTACGACAAAAT
Locus tag: Tlet_1844
Name: treX
Funciton: Predicted trehalose ABC transporter, substrate-binding component (Archaea-type)
Locus tag: Tlet_1843
Name: treY
Funciton: Predicted trehalose ABC transporter, permease component 1 (Archaea-type)
Locus tag: Tlet_1842
Name: treZ
Funciton: Predicted trehalose ABC transporter, permease component 2 (Archaea-type)
Locus tag: Tlet_1841
Name: treT
Funciton: Trehalose synthase, nucleoside diphosphate glucose dependent
Locus tag: Tlet_1840
Name: treR
Funciton: Regulator of trehalose utilization TreR, ROK family
treX-treY-treZ-treT-treR -8 5.7 ATTAATTCATGTTACGACAAAAT Tlet_1844
Thermotogales bacterium TBF 19.5.1
Position: -74
Score: 5.62443
Sequence: CTTTATTCAAGACTTGAATTTAT
Locus tag: Kole_0303
Name: treX
Funciton: Predicted trehalose ABC transporter, substrate-binding component (Archaea-type)
Locus tag: Kole_0302
Name: treY
Funciton: Predicted trehalose ABC transporter, permease component 1 (Archaea-type)
Locus tag: Kole_0301
Name: treZ
Funciton: Predicted trehalose ABC transporter, permease component 2 (Archaea-type)
Locus tag: Kole_0300
Name: treR
Funciton: Regulator of trehalose utilization TreR, ROK family
treX-treY-treZ-treR -74 5.6 CTTTATTCAAGACTTGAATTTAT Kole_0303
© 2009-2020 RegPrecise