Orthologous regulated operons containing fadH gene
| Regulog: | PsrA - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||||
|
Position: -182
Score: 5.01103 Sequence: GTCCAAACATTTGTTTGAAA
Locus tag: AHA_3357
Name: fadH Funciton: 2,4-dienoyl-CoA reductase (EC 1.3.1.34) |
||||
| fadH | -182 | 5 | GTCCAAACATTTGTTTGAAA | AHA_3357 |
| Aeromonas salmonicida subsp. salmonicida A449 | ||||
|
Position: -81
Score: 5.01103 Sequence: GTCCAAACATTTGTTTGAAA
Locus tag: ASA_0950
Name: fadH Funciton: 2,4-dienoyl-CoA reductase (EC 1.3.1.34) |
||||
| fadH | -81 | 5 | GTCCAAACATTTGTTTGAAA | ASA_0950 |
| Moritella sp. PE36 | ||||
|
Position: -132
Score: 4.35216 Sequence: GATTAAAATAGCGTTTGAAA
Position: -119
Score: 4.31587 Sequence: TTTGAAATGAACGATTAAAT
Locus tag: PE36_13067
Name: fadH Funciton: 2,4-dienoyl-CoA reductase (EC 1.3.1.34) |
||||
| fadH | -132 | 4.4 | GATTAAAATAGCGTTTGAAA | PE36_13067 |
| -119 | 4.3 | TTTGAAATGAACGATTAAAT | ||