Orthologous regulated operons containing psrA gene
| Regulog: | PsrA - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||||
|
Position: -30
Score: 5.38944 Sequence: TTTTAAACATTCGTTTAAGT
Locus tag: AHA_1345
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: AHA_1346
Name: fadE1 Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| psrA-fadE1 | -30 | 5.4 | TTTTAAACATTCGTTTAAGT | AHA_1345 |
| Aeromonas salmonicida subsp. salmonicida A449 | ||||
|
Position: -19
Score: 5.14055 Sequence: TTTTAAACATTCGTTTTAAG
Locus tag: ASA_1317
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: ASA_1318
Name: fadE1 Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| psrA-fadE1 | -19 | 5.1 | TTTTAAACATTCGTTTTAAG | ASA_1317 |
| Moritella sp. PE36 | ||||
|
Position: -81
Score: 5.31882 Sequence: TTTCAAACATTTGTTTACAT
Position: -30
Score: 5.58538 Sequence: TTTAAAACGTTCGTTTAAAA
Locus tag: PE36_04678
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: PE36_04673
Name: fadE1 Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| psrA-fadE1 | -81 | 5.3 | TTTCAAACATTTGTTTACAT | PE36_04678 |
| -30 | 5.6 | TTTAAAACGTTCGTTTAAAA | ||