Orthologous regulated operons containing SO3908 gene
| Regulog: | PsrA - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -69
Score: 5.46104 Sequence: AGTTAAACGTATGTTTGAAT
Locus tag: PBPRA2339
Name: SO3908 Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) |
||||
| SO3908 | -69 | 5.5 | AGTTAAACGTATGTTTGAAT | PBPRA2339 |