Orthologous regulated operons containing mdh gene
| Regulog: | PsrA - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio cholerae O1 biovar eltor str. N16961 | ||||
|
Position: -299
Score: 5.70953 Sequence: ATTTAAACACTTGTTTAAGT
Locus tag: VC0734
Name: mdh Funciton: Malate synthase (EC 2.3.3.9) |
||||
| mdh | -299 | 5.7 | ATTTAAACACTTGTTTAAGT | VC0734 |
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -348
Score: 5.56249 Sequence: ATTCATACACTTGTTTAAAT
Position: -265
Score: 5.56418 Sequence: AATCAAACACTTGTTTGATA
Locus tag: VIBHAR_01041
Name: mdh Funciton: Malate synthase (EC 2.3.3.9) |
||||
| mdh | -348 | 5.6 | ATTCATACACTTGTTTAAAT | VIBHAR_01041 |
| -265 | 5.6 | AATCAAACACTTGTTTGATA | ||
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -348
Score: 5.23123 Sequence: ATTCATACACCTGTTTTAAA
Locus tag: VP0583
Name: mdh Funciton: Malate synthase (EC 2.3.3.9) |
||||
| mdh | -348 | 5.2 | ATTCATACACCTGTTTTAAA | VP0583 |
| Vibrio vulnificus CMCP6 | ||||
|
Position: -270
Score: 5.17057 Sequence: AATCAAGCACTTGTTTGAAA
Locus tag: VV1_0450
Name: mdh Funciton: Malate synthase (EC 2.3.3.9) |
||||
| mdh | -270 | 5.2 | AATCAAGCACTTGTTTGAAA | VV1_0450 |