Orthologous regulated operons containing fadE gene
| Regulog: | PsrA - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio angustum S14 | ||||
|
Position: -33
Score: 5.74808 Sequence: ATTTAAACATGTGTTTAATA
Locus tag: VAS14_00861
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: VAS14_00866
Name: fadE Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| psrA-fadE | -33 | 5.7 | ATTTAAACATGTGTTTAATA | VAS14_00861 |
| Vibrio cholerae O1 biovar eltor str. N16961 | ||||
|
Position: 16
Score: 5.51909 Sequence: TTTCAAACAGTTGTTTGATA
Locus tag: VC1741
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: VC1740
Name: fadE Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| psrA-fadE | 16 | 5.5 | TTTCAAACAGTTGTTTGATA | VC1741 |
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -32
Score: 5.54536 Sequence: TTTCAAACAGTTGTTTAATA
Locus tag: VIBHAR_02639
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: VIBHAR_02638
Name: fadE Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| psrA-fadE | -32 | 5.5 | TTTCAAACAGTTGTTTAATA | VIBHAR_02639 |
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -32
Score: 5.54536 Sequence: TTTCAAACAGTTGTTTAATA
Locus tag: VP1229
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: VP1230
Name: fadE Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| psrA-fadE | -32 | 5.5 | TTTCAAACAGTTGTTTAATA | VP1229 |
| Vibrio shilonii AK1 | ||||
|
Position: -32
Score: 5.59604 Sequence: ATTCAAACATGTGTTTGATA
Locus tag: VSAK1_06350
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: VSAK1_06345
Name: fadE Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| psrA-fadE | -32 | 5.6 | ATTCAAACATGTGTTTGATA | VSAK1_06350 |
| Vibrio splendidus LGP32 | ||||
|
Position: -23
Score: 5.54536 Sequence: TTTCAAACAGTTGTTTAATA
Locus tag: VS_1841
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: VS_1840
Name: fadE Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| psrA-fadE | -23 | 5.5 | TTTCAAACAGTTGTTTAATA | VS_1841 |
| Vibrio vulnificus CMCP6 | ||||
|
Position: -32
Score: 5.51909 Sequence: TTTCAAACAGTTGTTTGATA
Locus tag: VV1_2832
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: VV1_2831
Name: fadE Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Locus tag: VV1_2830
Name: fadE Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| psrA-fadE-fadE | -32 | 5.5 | TTTCAAACAGTTGTTTGATA | VV1_2832 |