Orthologous regulated operons containing fadH gene
| Regulog: | PsrA - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -76
Score: 5.49486 Sequence: ATGTAAACAAATGTTTGAAA
Locus tag: PBPRA2594
Name: fadH Funciton: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
||||
| fadH | -76 | 5.5 | ATGTAAACAAATGTTTGAAA | PBPRA2594 |
| Vibrio angustum S14 | ||||
|
Position: -76
Score: 5.49486 Sequence: ATGTAAACAAATGTTTGAAA
Locus tag: VAS14_05978
Name: fadH Funciton: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
||||
| fadH | -76 | 5.5 | ATGTAAACAAATGTTTGAAA | VAS14_05978 |
| Vibrio cholerae O1 biovar eltor str. N16961 | ||||
|
Position: -81
Score: 5.55596 Sequence: ATGTAAACACTTGTTTGATT
Locus tag: VC1993
Name: fadH Funciton: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
||||
| fadH | -81 | 5.6 | ATGTAAACACTTGTTTGATT | VC1993 |
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -78
Score: 4.88467 Sequence: ATGTAAACGGCTGTTTGATC
Locus tag: VIBHAR_03043
Name: fadH Funciton: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
||||
| fadH | -78 | 4.9 | ATGTAAACGGCTGTTTGATC | VIBHAR_03043 |
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -87
Score: 5.48369 Sequence: ATGTAAACACCTGTTTGATT
Locus tag: VP2151
Name: fadH Funciton: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
||||
| fadH | -87 | 5.5 | ATGTAAACACCTGTTTGATT | VP2151 |
| Vibrio shilonii AK1 | ||||
|
Position: -82
Score: 4.9119 Sequence: ATGTAAACGCTAGTTTGATT
Locus tag: VSAK1_03494
Name: fadH Funciton: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
||||
| fadH | -82 | 4.9 | ATGTAAACGCTAGTTTGATT | VSAK1_03494 |
| Vibrio splendidus LGP32 | ||||
|
Position: -72
Score: 5.12467 Sequence: ATGTAAACGGTTGTTTGAAC
Locus tag: VS_0938
Name: fadH Funciton: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
||||
| fadH | -72 | 5.1 | ATGTAAACGGTTGTTTGAAC | VS_0938 |
| Vibrio vulnificus CMCP6 | ||||
|
Position: -77
Score: 5.37321 Sequence: ATGTAAACGCATGTTTGATT
Locus tag: VV1_3132
Name: fadH Funciton: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
||||
| fadH | -77 | 5.4 | ATGTAAACGCATGTTTGATT | VV1_3132 |