Orthologous regulated operons containing potC gene
| Regulog: | PuuR - Thermotogales |
| Regulator type: | Transcription factor |
| Regulator family: | XRE |
| Regulation mode: | |
| Biological process: | Spermidine biosynthesis |
| Effector: | Putrescine |
| Phylum: | Thermotogae |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Thermosipho africanus TCF52B | ||||
|
Position: -59
Score: 4.49399 Sequence: ATGTTCTGTATCATAGACAT
Position: -36
Score: 5.6224 Sequence: TTGTTCAGTATTATAGACAT
Locus tag: THA_1405
Name: puuR Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
Locus tag: THA_1404
Name: speD Funciton: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
Locus tag: THA_1403
Name: speE Funciton: Spermidine synthase (EC 2.5.1.16)
Locus tag: THA_1402
Name: potF Funciton: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
Locus tag: THA_1401
Name: potA Funciton: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
Locus tag: THA_1400
Name: potB Funciton: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
Locus tag: THA_1399
Name: potC Funciton: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1) |
||||
| puuR-speD-speE-potF-potA-potB-potC | -59 | 4.5 | ATGTTCTGTATCATAGACAT | THA_1405 |
| -36 | 5.6 | TTGTTCAGTATTATAGACAT | ||
| Thermosipho melanesiensis BI429 | ||||
|
Position: -32
Score: 5.48714 Sequence: TTGTTTAGTATTATAGACAT
Locus tag: Tmel_0572
Name: puuR Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
Locus tag: Tmel_0571
Name: speD Funciton: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
Locus tag: Tmel_0570
Name: speE Funciton: Spermidine synthase (EC 2.5.1.16)
Locus tag: Tmel_0569
Name: potF Funciton: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
Locus tag: Tmel_0568
Name: potA Funciton: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
Locus tag: Tmel_0567
Name: potB Funciton: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
Locus tag: Tmel_0566
Name: potC Funciton: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1) |
||||
| puuR-speD-speE-potF-potA-potB-potC | -32 | 5.5 | TTGTTTAGTATTATAGACAT | Tmel_0572 |