Orthologous regulated operons containing potB gene

Properties
Regulog:	PuuR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	XRE
Regulation mode:
Biological process:	Spermidine biosynthesis
Effector:	Putrescine
Phylum:	Thermotogae

Built upon 16 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermosipho africanus TCF52B
Position: -59 Score: 4.49399 Sequence: ATGTTCTGTATCATAGACAT Position: -36 Score: 5.6224 Sequence: TTGTTCAGTATTATAGACAT Locus tag: THA_1405 Name: puuR Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family Locus tag: THA_1404 Name: speD Funciton: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B Locus tag: THA_1403 Name: speE Funciton: Spermidine synthase (EC 2.5.1.16) Locus tag: THA_1402 Name: potF Funciton: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2) Locus tag: THA_1401 Name: potA Funciton: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1) Locus tag: THA_1400 Name: potB Funciton: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1) Locus tag: THA_1399 Name: potC Funciton: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
puuR-speD-speE-potF-potA-potB-potC	-59	4.5	ATGTTCTGTATCATAGACAT	THA_1405
	-36	5.6	TTGTTCAGTATTATAGACAT
Thermosipho melanesiensis BI429
Position: -32 Score: 5.48714 Sequence: TTGTTTAGTATTATAGACAT Locus tag: Tmel_0572 Name: puuR Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family Locus tag: Tmel_0571 Name: speD Funciton: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B Locus tag: Tmel_0570 Name: speE Funciton: Spermidine synthase (EC 2.5.1.16) Locus tag: Tmel_0569 Name: potF Funciton: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2) Locus tag: Tmel_0568 Name: potA Funciton: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1) Locus tag: Tmel_0567 Name: potB Funciton: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1) Locus tag: Tmel_0566 Name: potC Funciton: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
puuR-speD-speE-potF-potA-potB-potC	-32	5.5	TTGTTTAGTATTATAGACAT	Tmel_0572