Orthologous regulated operons containing omr gene

Properties
Regulog:	Zur - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/gamma

Built upon 51 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Hahella chejuensis KCTC 2396
Position: -66 Score: 4.93623 Sequence: AAAAAGATATGATGCAACATATC Locus tag: HCH_02943 Name: null Funciton: hypothetical protein Locus tag: HCH_02944 Name: omr Funciton: Zinc-regulated TonB-dependent outer membrane receptor Locus tag: HCH_02945 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: HCH_02946 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
HCH_02943-omr-znuA2-znuB2	-66	4.9	AAAAAGATATGATGCAACATATC	HCH_02943

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --