Orthologous regulated operons containing tmcD gene

Properties
Regulog:	TmcR - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:
Biological process:	Energy metabolism
Effector:
Phylum:	Proteobacteria/delta

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -217 Score: 6.14688 Sequence: TTCTATACCAAACAGGTATAGTA Position: -149 Score: 5.31088 Sequence: TACTCCACCACTACAGTATAGTT Position: -83 Score: 5.82314 Sequence: ATGTCTACCCAAAAGATAGAGTT Locus tag: Dde_3707 Name: tmcD Funciton: hypothetical protein Locus tag: Dde_3708 Name: tmcC Funciton: Transmembrane complex, integral membrane protein Locus tag: Dde_3709 Name: tmcB Funciton: Transmembrane complex, ferredoxin, 2 [4Fe-4S] Locus tag: Dde_3710 Name: tmcA Funciton: cytochrome c class III Locus tag: Dde_3711 Name: null Funciton: hypothetical protein Locus tag: Dde_3712 Name: null Funciton: Universal stress protein family Locus tag: Dde_3713 Name: mtrA Funciton: response regulator receiver protein Locus tag: Dde_3714 Name: divK Funciton: response regulator receiver protein Locus tag: Dde_3715 Name: null Funciton: multi-sensor signal transduction histidine kinase
tmcD-tmcC-tmcB-tmcA-Dde_3711-Dde_3712-mtrA-divK-Dde_3715	-217	6.1	TTCTATACCAAACAGGTATAGTA	Dde_3707
	-149	5.3	TACTCCACCACTACAGTATAGTT
	-83	5.8	ATGTCTACCCAAAAGATAGAGTT
Desulfovibrio vulgaris Hildenborough
Position: -182 Score: 5.87483 Sequence: TTGTCTACCATGACAGTAGTATT Locus tag: DVU0266 Name: tmcD Funciton: hypothetical protein Locus tag: DVU0265 Name: tmcC Funciton: Transmembrane complex, integral membrane protein Locus tag: DVU0264 Name: tmcB Funciton: Transmembrane complex, ferredoxin, 2 [4Fe-4S] Locus tag: DVU0263 Name: tmcA Funciton: cytochrome c class III Locus tag: DVU0262 Name: null Funciton: hypothetical protein Locus tag: DVU0261 Name: null Funciton: Universal stress protein family Locus tag: DVU0260 Name: mtrA Funciton: response regulator receiver protein Locus tag: DVU0259 Name: divK Funciton: response regulator receiver protein Locus tag: DVU0258 Name: null Funciton: multi-sensor signal transduction histidine kinase
tmcD-tmcC-tmcB-tmcA-DVU0262-DVU0261-mtrA-divK-DVU0258	-182	5.9	TTGTCTACCATGACAGTAGTATT	DVU0266
Desulfovibrio vulgaris str. Miyazaki F
Position: -195 Score: 5.6944 Sequence: AACTATACCATTGCAGTATACAA Position: -170 Score: 6.13729 Sequence: AAATCTACCACGCAAGTAGACTA Locus tag: DvMF_2557 Name: tmcD Funciton: hypothetical protein Locus tag: DvMF_2556 Name: tmcC Funciton: Transmembrane complex, integral membrane protein Locus tag: DvMF_2555 Name: tmcB Funciton: Transmembrane complex, ferredoxin, 2 [4Fe-4S] Locus tag: DvMF_2554 Name: tmcA Funciton: cytochrome c class III Locus tag: DvMF_2553 Name: null Funciton: hypothetical protein Locus tag: DvMF_2552 Name: null Funciton: Universal stress protein family Locus tag: DvMF_2551 Name: null Funciton: response regulator receiver protein Locus tag: DvMF_2550 Name: null Funciton: multi-sensor signal transduction histidine kinase
tmcD-tmcC-tmcB-tmcA-DvMF_2553-DvMF_2552-DvMF_2551-DvMF_2550	-195	5.7	AACTATACCATTGCAGTATACAA	DvMF_2557
	-170	6.1	AAATCTACCACGCAAGTAGACTA