Orthologous regulated operons containing Dret_0871 gene

Properties
Regulog:	HmcR - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:
Biological process:	Energy metabolism
Effector:
Phylum:	Proteobacteria/delta

Built upon 12 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Desulfohalobium retbaense DSM 5692
Position: -158 Score: 5.06 Sequence: TCGCCTACTCAGCCGGTAGGTTT Position: -133 Score: 5.49097 Sequence: ATACCTACCACTGAAGTAGGATT Locus tag: Dret_0877 Name: hmcA Funciton: High-molecular-weight cytochrome c precursor Locus tag: Dret_0876 Name: hmcB Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein Locus tag: Dret_0875 Name: hmcC Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit Locus tag: Dret_0874 Name: hmcD Funciton: hmc operon protein 4 Locus tag: Dret_0873 Name: hmcE Funciton: hmc operon protein 5 Locus tag: Dret_0872 Name: hmcF Funciton: protein of unknown function DUF224 cysteine-rich region domain protein Locus tag: Dret_0871 Name: null Funciton: Universal stress protein family Locus tag: Dret_0870 Name: null Funciton: response regulator receiver protein Locus tag: Dret_0869 Name: null Funciton: response regulator receiver protein Locus tag: Dret_0868 Name: null Funciton: multi-sensor signal transduction histidine kinase Locus tag: Dret_0867 Name: hmcR Funciton: Transcriptional regulator, BadM/Rrf2 family
hmcA-hmcB-hmcC-hmcD-hmcE-hmcF-Dret_0871-Dret_0870-Dret_0869-Dret_0868-hmcR	-158	5.1	TCGCCTACTCAGCCGGTAGGTTT	Dret_0877
	-133	5.5	ATACCTACCACTGAAGTAGGATT
Desulfomicrobium baculatum DSM 4028
Position: -194 Score: 4.58292 Sequence: TTCTATACCTCCGAGGTCGGAAT Locus tag: Dbac_0568 Name: hmcA Funciton: High-molecular-weight cytochrome c precursor Locus tag: Dbac_0569 Name: hmcB Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein Locus tag: Dbac_0570 Name: hmcC Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit Locus tag: Dbac_0571 Name: hmcD Funciton: hmc operon protein 4 Locus tag: Dbac_0572 Name: hmcE Funciton: hmc operon protein 5 Locus tag: Dbac_0573 Name: hmcF Funciton: protein of unknown function DUF224 cysteine-rich region domain protein Locus tag: Dbac_0574 Name: null Funciton: Universal stress protein family Locus tag: Dbac_0575 Name: null Funciton: response regulator receiver protein Locus tag: Dbac_0576 Name: null Funciton: multi-sensor signal transduction histidine kinase Locus tag: Dbac_0577 Name: hmcR Funciton: Transcriptional regulator, BadM/Rrf2 family
hmcA-hmcB-hmcC-hmcD-hmcE-hmcF-Dbac_0574-Dbac_0575-Dbac_0576-hmcR	-194	4.6	TTCTATACCTCCGAGGTCGGAAT	Dbac_0568
Desulfovibrio salexigens DSM 2638
Position: -226 Score: 5.53272 Sequence: TAACATACCTATCGAGCAGGTAT Position: -201 Score: 4.74125 Sequence: AAACCTATCTATTGAGGAGGTAT Position: -176 Score: 4.51788 Sequence: ATACCAACCCGATGGATGGGAAA Locus tag: Desal_1378 Name: hmcA Funciton: High-molecular-weight cytochrome c precursor Locus tag: Desal_1377 Name: hmcB Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein Locus tag: Desal_1376 Name: hmcC Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit Locus tag: Desal_1375 Name: hmcD Funciton: hmc operon protein 4 Locus tag: Desal_1374 Name: hmcE Funciton: hmc operon protein 5 Locus tag: Desal_1373 Name: hmcF Funciton: protein of unknown function DUF224 cysteine-rich region domain protein Locus tag: Desal_1372 Name: null Funciton: Universal stress protein family Locus tag: Desal_1371 Name: null Funciton: response regulator receiver protein Locus tag: Desal_1370 Name: null Funciton: response regulator receiver protein Locus tag: Desal_1369 Name: null Funciton: multi-sensor signal transduction histidine kinase Locus tag: Desal_1368 Name: hmcR Funciton: Transcriptional regulator, BadM/Rrf2 family
hmcA-hmcB-hmcC-hmcD-hmcE-hmcF-Desal_1372-Desal_1371-Desal_1370-Desal_1369-hmcR	-226	5.5	TAACATACCTATCGAGCAGGTAT	Desal_1378
	-201	4.7	AAACCTATCTATTGAGGAGGTAT
	-176	4.5	ATACCAACCCGATGGATGGGAAA